Stem-loop sequence eca-mir-342

AccessionMI0012884 (change log)
DescriptionEquus caballus miR-342 stem-loop
Gene family MIPF0000190; mir-342
Stem-loop
   gaaccu    u        g      --ua      auuga      ugg a 
5'       gggc caagguga gggugc    ucugug     gggaca   c a
         |||| |||||||| ||||||    ||||||     ||||||   | a
3'       cccg guuccacu cccacg    agacac     cucugu   g u
   -auccg    -        g      cuaa      ----a      uaa a 
Get sequence
Deep sequencing
1018 reads, 50 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr24: 42060853-42060951 [+]
sense
ENSECAT00000013109 ; EVL-201; intron 3
ENSECAT00000013125 ; EVL-202; intron 3
ENSECAT00000013170 ; EVL-203; intron 3
Database links

Mature sequence eca-miR-342-5p

Accession MIMAT0013136
Sequence

19 - 

aggggugcuaucugugauugag

 - 40

Get sequence
Deep sequencing46 reads, 1 experiments
Evidence not experimental

Mature sequence eca-miR-342-3p

Accession MIMAT0013137
Sequence

61 - 

ucucacacagaaaucgcacccgu

 - 83

Get sequence
Deep sequencing972 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).