Stem-loop sequence eca-mir-329a

AccessionMI0012882 (change log)
Previous IDseca-mir-329
DescriptionEquus caballus miR-329 stem-loop
Gene family MIPF0000110; mir-329
Stem-loop
   guguuaaucag      cu           uu      uuc      uuuaa 
5'            ugguac  gaagagagguu  cugggu   uguuuc     u
              ||||||  |||||||||||  ||||||   ||||||      
3'            acuaug  cuuuucuccaa  gaucca   acaaag     g
   ------ccuag      ac           uu      --c      uagaa 
Get sequence
Deep sequencing
53 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr24: 42899352-42899449 [+]
intergenic
Clustered miRNAs
< 10kb from eca-mir-329a
eca-mir-379chr24: 42894643-42894709 [+]
eca-mir-411chr24: 42895895-42895976 [+]
eca-mir-299chr24: 42896363-42896425 [+]
eca-mir-380chr24: 42897592-42897652 [+]
eca-mir-1197chr24: 42898113-42898232 [+]
eca-mir-323chr24: 42898304-42898389 [+]
eca-mir-758chr24: 42898599-42898683 [+]
eca-mir-329achr24: 42899352-42899449 [+]
eca-mir-329bchr24: 42899649-42899789 [+]
eca-mir-494chr24: 42902171-42902251 [+]
eca-mir-1193chr24: 42902577-42902697 [+]
eca-mir-543chr24: 42904247-42904318 [+]
eca-mir-495chr24: 42906084-42906165 [+]
eca-mir-3958chr24: 42908032-42908174 [+]
Database links

Mature sequence eca-miR-329a

Accession MIMAT0013133
Previous IDseca-miR-329
Sequence

62 - 

aacacaccuaguuaaccucuuu

 - 83

Get sequence
Deep sequencing43 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).