Stem-loop sequence eca-mir-323

AccessionMI0012881 (change log)
DescriptionEquus caballus miR-323 stem-loop
Gene family MIPF0000018; mir-154
Literature search

1 open access papers mention eca-mir-323
(2 sentences)

Stem-loop
   ---uu      u g        g u     gcgc  u    uua 
5'      gguacu g agagaggu g ccgug    gu cgcu   u
        |||||| | |||||||| | |||||    || ||||    
3'      cuauga c uuucucca c ggcac    ca gcgg   u
   cuaau      - g        g u     auua  c    uau 
Get sequence
Deep sequencing
180 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr24: 42898304-42898389 [+]
intergenic
Clustered miRNAs
< 10kb from eca-mir-323
eca-mir-379chr24: 42894643-42894709 [+]
eca-mir-411chr24: 42895895-42895976 [+]
eca-mir-299chr24: 42896363-42896425 [+]
eca-mir-380chr24: 42897592-42897652 [+]
eca-mir-1197chr24: 42898113-42898232 [+]
eca-mir-323chr24: 42898304-42898389 [+]
eca-mir-758chr24: 42898599-42898683 [+]
eca-mir-329achr24: 42899352-42899449 [+]
eca-mir-329bchr24: 42899649-42899789 [+]
eca-mir-494chr24: 42902171-42902251 [+]
eca-mir-1193chr24: 42902577-42902697 [+]
eca-mir-543chr24: 42904247-42904318 [+]
eca-mir-495chr24: 42906084-42906165 [+]
eca-mir-3958chr24: 42908032-42908174 [+]
Database links

Mature sequence eca-miR-323-5p

Accession MIMAT0013131
Sequence

16 - 

aggugguccguggcgcguucgc

 - 37

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence not experimental

Mature sequence eca-miR-323-3p

Accession MIMAT0013132
Sequence

51 - 

cacauuacacggucgaccucu

 - 71

Get sequence
Deep sequencing179 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).