Stem-loop sequence eca-mir-154a

AccessionMI0012879 (change log)
Previous IDseca-mir-154
DescriptionEquus caballus miR-154 stem-loop
Gene family MIPF0000018; mir-154
Literature search

1 open access papers mention eca-mir-154a
(2 sentences)

Stem-loop
   --        uau      ugcc    - uuu 
5'   agauaggu   ccgugu    uucg c   a
     ||||||||   ||||||    |||| |   u
3'   uuuaucca   ggcaca    aagc g   c
   uu        cuu      uacu    a ugu 
Get sequence
Deep sequencing
46 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr24: 42930163-42930226 [+]
intergenic
Clustered miRNAs
< 10kb from eca-mir-154a
eca-mir-3959chr24: 42921540-42921650 [+]
eca-mir-487achr24: 42921992-42922071 [+]
eca-mir-382chr24: 42924862-42924937 [+]
eca-mir-134chr24: 42925245-42925315 [+]
eca-mir-485chr24: 42925986-42926058 [+]
eca-mir-154achr24: 42930163-42930226 [+]
eca-mir-154bchr24: 42930413-42930553 [+]
eca-mir-496chr24: 42930990-42931092 [+]
eca-mir-377chr24: 42932739-42932807 [+]
eca-mir-541chr24: 42934714-42934797 [+]
eca-mir-409chr24: 42935634-42935712 [+]
eca-mir-412chr24: 42935784-42935863 [+]
eca-mir-369chr24: 42935933-42936002 [+]
eca-mir-410chr24: 42936264-42936337 [+]
eca-mir-656chr24: 42937011-42937088 [+]
Database links

Mature sequence eca-miR-154a

Accession MIMAT0013129
Previous IDseca-miR-154
Sequence

4 - 

uagguuauccguguugccuucg

 - 25

Get sequence
Deep sequencing39 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).