Stem-loop sequence eca-mir-134

AccessionMI0012877 (change log)
DescriptionEquus caballus miR-134 stem-loop
Gene family MIPF0000112; mir-134
Literature search

1 open access papers mention eca-mir-134
(1 sentences)

Stem-loop
        gu        u  -a   g    gca   a 
5' agggu  gugacugg ug  cca aggg   agc c
   |||||  |||||||| ||  ||| ||||   ||| u
3' uccca  cacugauc ac  ggu uccc   uug c
        ac        c  cg   g    -ac   u 
Get sequence
Deep sequencing
258 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr24: 42925245-42925315 [+]
sense
ENSECAT00000028585 ; eca-mir-134-201; exon 1
Clustered miRNAs
< 10kb from eca-mir-134
eca-mir-381chr24: 42916054-42916128 [+]
eca-mir-487bchr24: 42916520-42916603 [+]
eca-mir-539chr24: 42917365-42917442 [+]
eca-mir-889chr24: 42917940-42918017 [+]
eca-mir-544-2chr24: 42918692-42918781 [+]
eca-mir-655chr24: 42919594-42919690 [+]
eca-mir-3959chr24: 42921540-42921650 [+]
eca-mir-487achr24: 42921992-42922071 [+]
eca-mir-382chr24: 42924862-42924937 [+]
eca-mir-134chr24: 42925245-42925315 [+]
eca-mir-485chr24: 42925986-42926058 [+]
eca-mir-154achr24: 42930163-42930226 [+]
eca-mir-154bchr24: 42930413-42930553 [+]
eca-mir-496chr24: 42930990-42931092 [+]
eca-mir-377chr24: 42932739-42932807 [+]
eca-mir-541chr24: 42934714-42934797 [+]
Database links

Mature sequence eca-miR-134

Accession MIMAT0013127
Sequence

7 - 

ugugacugguugaccagagggg

 - 28

Get sequence
Deep sequencing251 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).