Stem-loop sequence eca-mir-127

AccessionMI0012876 (change log)
DescriptionEquus caballus miR-127 stem-loop
Gene family MIPF0000080; mir-127
Literature search

2 open access papers mention eca-mir-127
(93 sentences)

Stem-loop
   ----      ugcug         g  c      --  a 
5'     ccagcc     aagcucaga gg ucugau  uc g
       ||||||     ||||||||| || ||||||  || a
3'     ggucgg     uucgagucu cc aggcua  ag a
   ggcu      -----         g  u      cu  a 
Get sequence
Deep sequencing
163055 reads, 1.17e+04 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr24: 42747005-42747074 [+]
sense
ENSECAT00000028036 ; eca-mir-127-201; exon 1
antisense
ENSECAT00000005871 ; eca-mir-433-201; exon 1
Clustered miRNAs
< 10kb from eca-mir-127
eca-mir-337chr24: 42738909-42739000 [+]
eca-mir-431chr24: 42745020-42745108 [+]
eca-mir-433chr24: 42745895-42746018 [+]
eca-mir-127chr24: 42747005-42747074 [+]
eca-mir-432chr24: 42748485-42748573 [+]
eca-mir-136chr24: 42748685-42748746 [+]
Database links

Mature sequence eca-miR-127

Accession MIMAT0013126
Sequence

43 - 

ucggauccgucugagcuuggcu

 - 64

Get sequence
Deep sequencing162487 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).