Stem-loop sequence eca-mir-1197

AccessionMI0012875 (change log)
DescriptionEquus caballus miR-1197 stem-loop
Gene family MIPF0000126; mir-379
Stem-loop
   gggagagaggcugggucagcgucacuuca       u  a  u c   u       c  - g    - uuu 
5'                              ugguauu ga ga g ggu gaccaug ug u uacg c   a
                                ||||||| || || | ||| ||||||| || | |||| |   u
3'                              acuauaa cu cu c uca cugguac ac g augc g   u
   --------------------ccgcucuac       -  c  - u   u       -  a g    a uau 
Get sequence
Deep sequencing
21 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr24: 42898113-42898232 [+]
intergenic
Clustered miRNAs
< 10kb from eca-mir-1197
eca-mir-379chr24: 42894643-42894709 [+]
eca-mir-411chr24: 42895895-42895976 [+]
eca-mir-299chr24: 42896363-42896425 [+]
eca-mir-380chr24: 42897592-42897652 [+]
eca-mir-1197chr24: 42898113-42898232 [+]
eca-mir-323chr24: 42898304-42898389 [+]
eca-mir-758chr24: 42898599-42898683 [+]
eca-mir-329achr24: 42899352-42899449 [+]
eca-mir-329bchr24: 42899649-42899789 [+]
eca-mir-494chr24: 42902171-42902251 [+]
eca-mir-1193chr24: 42902577-42902697 [+]
eca-mir-543chr24: 42904247-42904318 [+]
eca-mir-495chr24: 42906084-42906165 [+]
eca-mir-3958chr24: 42908032-42908174 [+]
Database links

Mature sequence eca-miR-1197

Accession MIMAT0013125
Sequence

80 - 

uaggacacauggucuacuucu

 - 100

Get sequence
Deep sequencing20 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).