Stem-loop sequence eca-mir-1193

AccessionMI0012874 (change log)
DescriptionEquus caballus miR-1193 stem-loop
Gene family MIPF0000714; mir-1193
Stem-loop
   ugaagggacuguagugccauccacucugca    a     gg       -    c      g    cu   u 
5'                               gggu gcuga  ggauggu agac ggugac ugca  uca u
                                 |||| |||||  ||||||| |||| |||||| ||||  |||  
3'                               ccca cgacu  ccuauca uuug ccacug augu  agu u
   --------------------gucuaccuga    -     -a       g    c      g    --   a 
Get sequence
Deep sequencing
17 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr24: 42902577-42902697 [+]
intergenic
Clustered miRNAs
< 10kb from eca-mir-1193
eca-mir-379chr24: 42894643-42894709 [+]
eca-mir-411chr24: 42895895-42895976 [+]
eca-mir-299chr24: 42896363-42896425 [+]
eca-mir-380chr24: 42897592-42897652 [+]
eca-mir-1197chr24: 42898113-42898232 [+]
eca-mir-323chr24: 42898304-42898389 [+]
eca-mir-758chr24: 42898599-42898683 [+]
eca-mir-329achr24: 42899352-42899449 [+]
eca-mir-329bchr24: 42899649-42899789 [+]
eca-mir-494chr24: 42902171-42902251 [+]
eca-mir-1193chr24: 42902577-42902697 [+]
eca-mir-543chr24: 42904247-42904318 [+]
eca-mir-495chr24: 42906084-42906165 [+]
eca-mir-3958chr24: 42908032-42908174 [+]
eca-mir-376cchr24: 42911104-42911169 [+]
eca-mir-376bchr24: 42911856-42911937 [+]
eca-mir-376achr24: 42912234-42912301 [+]
Database links

Mature sequence eca-miR-1193

Accession MIMAT0013124
Sequence

80 - 

uaggucacccguuugacuauc

 - 100

Get sequence
Deep sequencing10 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).