Stem-loop sequence eca-mir-1185

AccessionMI0012873 (change log)
DescriptionEquus caballus miR-1185 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
   u       u    -     ga a              acu   u 
5'  uugguac ugaa gagag  u cccuuuguauguuc   uca u
    ||||||| |||| |||||  | ||||||||||||||   |||  
3'  aacuaug guuu uucuc  a gggggacauauaag   agu a
   a       c    a     ag -              --c   a 
Get sequence
Deep sequencing
35 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr24: 42914351-42914436 [+]
intergenic
Clustered miRNAs
< 10kb from eca-mir-1185
eca-mir-495chr24: 42906084-42906165 [+]
eca-mir-3958chr24: 42908032-42908174 [+]
eca-mir-376cchr24: 42911104-42911169 [+]
eca-mir-376bchr24: 42911856-42911937 [+]
eca-mir-376achr24: 42912234-42912301 [+]
eca-mir-1185chr24: 42914351-42914436 [+]
eca-mir-381chr24: 42916054-42916128 [+]
eca-mir-487bchr24: 42916520-42916603 [+]
eca-mir-539chr24: 42917365-42917442 [+]
eca-mir-889chr24: 42917940-42918017 [+]
eca-mir-544-2chr24: 42918692-42918781 [+]
eca-mir-655chr24: 42919594-42919690 [+]
eca-mir-3959chr24: 42921540-42921650 [+]
eca-mir-487achr24: 42921992-42922071 [+]
Database links

Mature sequence eca-miR-1185

Accession MIMAT0013123
Sequence

15 - 

agaggauacccuuuguauguu

 - 35

Get sequence
Deep sequencing10 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).