Stem-loop sequence eca-mir-7-3

AccessionMI0012869 (change log)
DescriptionEquus caballus miR-7-3 stem-loop
Gene family MIPF0000022; mir-7
Literature search

1 open access papers mention eca-mir-7-3
(4 sentences)

Stem-loop
   uggucua  u        a     a       u      --ug   a 
5'        gu cugugugg agacu gugauuu guuguu    uag u
          || |||||||| ||||| ||||||| ||||||    |||  
3'        ca gguauacc ucuga cacuaaa caacag    auc a
   ----gga  c        g     -       -      cuaa   a 
Get sequence
Deep sequencing
49 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr23: 6798793-6798880 [-]
sense
ENSECAT00000027118 ; HNRNPK-201; intron 15
Database links

Mature sequence eca-miR-7

Accession MIMAT0012905
Sequence

16 - 

uggaagacuagugauuuuguugu

 - 38

Get sequence
Deep sequencing126 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).