Stem-loop sequence eca-mir-544b

AccessionMI0012868 (change log)
DescriptionEquus caballus miR-544b stem-loop
Gene family MIPF0000436; mir-544
Stem-loop
   ggcau          -c     --     -a    --g  g 
5'      cuuguuaaaa  gcaga  cuugg  uuca   ca g
        ||||||||||  |||||  |||||  ||||   ||  
3'      gaacaauuuu  cgucu  gaacc  gagu   gu u
   --cuu          ua     ua     cg    agg  c 
Get sequence
Deep sequencing
4 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr23: 5343865-5343940 [+]
antisense
ENSECAT00000012843 ; NTRK2-201; intron 11
ENSECAT00000012850 ; NTRK2-202; intron 11
Database links

Mature sequence eca-miR-544b

Accession MIMAT0013118
Sequence

55 - 

auucugcauuuuuaacaaguuc

 - 76

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).