Stem-loop sequence eca-mir-101-2

AccessionMI0012861 (change log)
DescriptionEquus caballus miR-101-2 stem-loop
Gene family MIPF0000046; mir-101
Literature search

1 open access papers mention eca-mir-101-2
(2 sentences)

Stem-loop
   --  -                    c a    guaua 
5'   cc uuuuucgguuaucaugguac g ugcu     u
     || |||||||||||||||||||| | ||||      
3'   gg aagaagucaauagugucaug c augg     c
   gu  u                    a -    aaagu 
Get sequence
Deep sequencing
13688 reads, 850 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr23: 26335600-26335671 [+]
sense
ENSECAT00000027281 ; eca-mir-101-2-201; exon 1
ENSECAT00000016989 ; RCL1-201; intron 7
Database links

Mature sequence eca-miR-101

Accession MIMAT0012951
Sequence

44 - 

uacaguacugugauaacugaa

 - 64

Get sequence
Deep sequencing19958 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).