Stem-loop sequence eca-let-7f

AccessionMI0012860 (change log)
DescriptionEquus caballus let-7f stem-loop
Gene family MIPF0000002; let-7
Literature search

6 open access papers mention eca-let-7f
(13 sentences)

Stem-loop
       a ug                      ---------       u 
5' ucgg g  agguaguagauuguauaguugu         gggguag g
   |||| |  ||||||||||||||||||||||         ||||||| a
3' aguc c  uccguuaucuaacauaucaaua         ucccauu u
       - cu                      gaggacuug       u 
Get sequence
Deep sequencing
188237 reads, 1.38e+04 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr23: 54150758-54150844 [-]
intergenic
Clustered miRNAs
< 10kb from eca-let-7f
eca-let-7fchr23: 54150758-54150844 [-]
eca-let-7dchr23: 54148818-54148904 [-]
Database links

Mature sequence eca-let-7f

Accession MIMAT0013111
Sequence

7 - 

ugagguaguagauuguauaguu

 - 28

Get sequence
Deep sequencing188200 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).