Stem-loop sequence eca-mir-499

AccessionMI0012858 (change log)
DescriptionEquus caballus miR-499 stem-loop
Gene family MIPF0000173; mir-499
Literature search

2 open access papers mention eca-mir-499
(2 sentences)

Stem-loop
   u uu      ccu   c c    --    c   u  ua        a          acucc 
5'  g  cugucc   gca c uggg  cggg ggc gu  agacuugc gugauguuua     u
    |  ||||||   ||| | ||||  |||| ||| ||  |||||||| ||||||||||     c
3'  u  gacggg   cgu g accc  gccc ucg cg  ucugaacg cacuacaagu     u
   - gg      -uc   c u    cu    u   u  ug        a          gcacc 
Get sequence
Deep sequencing
26 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr22: 25813224-25813346 [+]
sense
ENSECAT00000018068 ; MYH7B-201; intron 18
Database links

Mature sequence eca-miR-499-5p

Accession MIMAT0013108
Sequence

34 - 

uuaagacuugcagugauguuu

 - 54

Get sequence
Deep sequencing26 reads, 1 experiments
Evidence not experimental

Mature sequence eca-miR-499-3p

Accession MIMAT0013109
Sequence

71 - 

aacaucacagcaagucugugcu

 - 92

Get sequence
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).