Stem-loop sequence eca-mir-296

Accession MI0012857
Description Equus caballus miR-296 stem-loop
Gene family MIPF0000159; mir-296
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-296. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-296 is a family of microRNA precursors found in mammals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC which effects RNA interference. miR-296 has been named an "angiomiR" due to being characterised as a microRNA which regulates angiogenesis, the process of growth and creation of new blood vessels. miR-296 is thought to have a specific role in cancer in promoting tumour angiogenesis. It achieves this by targeting HGS mRNA, reducing its expression in endothelial cells which then results in greater number of VEGF receptors. miR-296 has predicted target sites in the transcription factor NANOG and may also contribute to carcinogenesis by dysregulating p53.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
a   cu    c        c  -         g   ugu 
 gga  cuuc ggagggcc cc cccaauccu uug   u
 |||  |||| |||||||| || ||||||||| |||   u
 ucu  gaag ccuuucgg gg ggguuggga gac   g
-   cg    u        a  u         -   uua 
Get sequence
Genome context
Coordinates (EquCab2) Overlapping transcripts
22: 45210449-45210526 [-]
antisense
ENSECAT00000023994 ; NPEPL1; intron 11
Database links

Mature sequence eca-miR-296

Accession MIMAT0013107
Sequence

47 - 

gaggguuggguggaggcuuucc

 - 68

Get sequence
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).