Stem-loop sequence eca-mir-103

AccessionMI0012854 (change log)
DescriptionEquus caballus miR-103 stem-loop
Gene family MIPF0000024; mir-103
Literature search

3 open access papers mention eca-mir-103
(11 sentences)

Stem-loop
   uc  g      --   u  u           ----    ua 
5'   gu cuuuca  gcu cu uacagugcugc    cuug  g
     || ||||||  ||| || |||||||||||    ||||  c
3'   ca gaaagu  cgg ga auguuacgacg    ggac  a
   ac  a      au   -  c           aacu    uu 
Get sequence
Deep sequencing
8486 reads, 400 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr22: 19043286-19043363 [-]
sense
ENSECAT00000027419 ; eca-mir-103-201; exon 1
ENSECAT00000018679 ; PANK2-201; intron 5
Database links

Mature sequence eca-miR-103

Accession MIMAT0013105
Sequence

48 - 

agcagcauuguacagggcuauga

 - 70

Get sequence
Deep sequencing8478 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).