Stem-loop sequence eca-mir-1-2

AccessionMI0012853 (change log)
DescriptionEquus caballus miR-1-2 stem-loop
Gene family MIPF0000038; mir-1
Literature search

5 open access papers mention eca-mir-1-2
(14 sentences)

Stem-loop
   g    gg a                gc     ---   a 
5'  cuug  a acauacuucuuuauau  ccaua   ugg c
    ||||  | ||||||||||||||||  |||||   ||| c
3'  ggac  u uguaugaagaaaugua  gguau   auc u
   -    uu a                -a     cga   g 
Get sequence
Deep sequencing
103 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr22: 48433506-48433581 [+]
intergenic
Database links

Mature sequence eca-miR-1

Accession MIMAT0012994
Sequence

49 - 

uggaauguaaagaaguauguau

 - 70

Get sequence
Deep sequencing206 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).