Stem-loop sequence eca-mir-1898

AccessionMI0012850 (change log)
DescriptionEquus caballus miR-1898 stem-loop
Gene family MIPF0000786; mir-1898
Stem-loop
             uc     gg  -      au 
5' aggucaaggu  acagg  au caagaa  a
   ||||||||||  |||||  || ||||||   
3' uccaguuuca  ugucu  ua guucuu  u
             uu     aa  u      au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr21: 31945364-31945424 [+]
sense
ENSECAT00000014091 ; ZFR-201; intron 15
Database links

Mature sequence eca-miR-1898

Accession MIMAT0013101
Sequence

1 - 

aggucaagguucacaggggauc

 - 22

Get sequence
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).