Stem-loop sequence eca-mir-30c-2

AccessionMI0012849 (change log)
DescriptionEquus caballus miR-30c-2 stem-loop
Gene family MIPF0000005; mir-30
Literature search

3 open access papers mention eca-mir-30c-2
(5 sentences)

Stem-loop
   u       u   aca         guggaa 
5'  guaaaca ccu   cucucagcu      a
    ||||||| |||   |||||||||       
3'  cauuugu gga   gagggucga      g
   u       c   --a         aagagu 
Get sequence
Deep sequencing
7506 reads, 450 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr20: 62697749-62697808 [-]
intergenic
Database links

Mature sequence eca-miR-30c

Accession MIMAT0012915
Sequence

1 - 

uguaaacauccuacacucucagc

 - 23

Get sequence
Deep sequencing15006 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).