Stem-loop sequence eca-mir-219-1

Accession MI0012846
Previous IDs eca-mir-219
Description Equus caballus miR-219 stem-loop
Gene family MIPF0000044; mir-219
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-219_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, the microRNA miR-219 was predicted in vertebrates by conservation between human, mouse and pufferfish and cloned in pufferfish. It was later predicted and confirmed experimentally in Drosophila. Homologs of miR-219 have since been predicted or experimentally confirmed in a wide range of species, including the platyhelminth Schmidtea mediterranea, several arthropod species and a wide range of vertebrates (MIPF0000044). The hairpin precursors (represented here) are predicted based on base pairing and cross-species conservation; their extents are not known. In this case, the mature sequence is excised from the 5' arm of the hairpin. miR-219 has also been linked with NMDA receptor signalling in humans, and it has been suggested that deregulation of this miRNA can lead to the expression of mental disorders such as schizophrenia.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
    c       uu   u     a  g         a   ucu 
gggc gcggcuc  gau gucca ac caauucucg guc   g
|||| |||||||  ||| ||||| || ||||||||| |||   g
cccg cgccgag  cug caggu ug guugagagc cgg   c
    c       cc   -     c  a         -   ccu 
Get sequence
Genome context
Coordinates (EquCab2) Overlapping transcripts
20: 33649525-33649611 [+]
intergenic
Database links

Mature sequence eca-miR-219-5p

Accession MIMAT0013099
Sequence

14 - 

ugauuguccaaacgcaauucu

 - 34

Get sequence
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).