Stem-loop sequence eca-mir-206-2

AccessionMI0012845 (change log)
DescriptionEquus caballus miR-206-2 stem-loop
Gene family MIPF0000038; mir-1
Literature search

3 open access papers mention eca-mir-206-2
(12 sentences)

Stem-loop
   -                     cc     -    u 
5'  aggccacaugcuucuuuauau  ccaua cgga u
    |||||||||||||||||||||  ||||| ||||  
3'  uuuggugugugaaggaaugua  gguau guuu a
   c                     -a     c    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr20: 49820595-49820663 [+]
intergenic
Clustered miRNAs
< 10kb from eca-mir-206-2
eca-mir-206-2chr20: 49820595-49820663 [+]
eca-mir-133bchr20: 49824706-49824766 [+]
Database links

Mature sequence eca-miR-206

Accession MIMAT0013098
Sequence

44 - 

uggaauguaaggaagugugugg

 - 65

Get sequence
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).