Stem-loop sequence eca-mir-133b

AccessionMI0012844 (change log)
DescriptionEquus caballus miR-133b stem-loop
Gene family MIPF0000029; mir-133
Literature search

5 open access papers mention eca-mir-133b
(12 sentences)

Stem-loop
           ca  c  a      u  g      
5' uggcuggu  aa gg accaag cc ucuuc 
   ||||||||  || || |||||| || |||| c
3' aucgacca  uu cc ugguuu gg agagu 
           ac  c  c      -  -      
Get sequence
Deep sequencing
126 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr20: 49824706-49824766 [+]
intergenic
Clustered miRNAs
< 10kb from eca-mir-133b
eca-mir-206-2chr20: 49820595-49820663 [+]
eca-mir-133bchr20: 49824706-49824766 [+]
Database links

Mature sequence eca-miR-133b

Accession MIMAT0013097
Sequence

40 - 

uuugguccccuucaaccagcua

 - 61

Get sequence
Deep sequencing126 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).