Stem-loop sequence eca-mir-568

AccessionMI0012842 (change log)
DescriptionEquus caballus miR-568 stem-loop
Gene family MIPF0000408; mir-568
Literature search

1 open access papers mention eca-mir-568
(1 sentences)

Stem-loop
           a         acuucc        u 
5' auguauaa uguauacac      uauauaua c
   |||||||| |||||||||      ||||||||  
3' uacauauu auauaugug      auauauau c
           -         ------        a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr19: 43734251-43734311 [+]
intergenic
Database links

Mature sequence eca-miR-568

Accession MIMAT0013095
Sequence

1 - 

auguauaaauguauacacac

 - 20

Get sequence
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).