Stem-loop sequence eca-mir-28

AccessionMI0012840 (change log)
DescriptionEquus caballus miR-28 stem-loop
Gene family MIPF0000057; mir-28
Literature search

2 open access papers mention eca-mir-28
(2 sentences)

Stem-loop
      c         a                u  ----    gcc 
5' ggu cuugcccuc aggagcucacagucua ug    aguu   u
   ||| ||||||||| |||||||||||||||| ||    ||||    
3' uca ggacgggag uccucgaguguuagau ac    ucag   u
      c         g                c  ccuu    ucu 
Get sequence
Deep sequencing
57146 reads, 3.95e+03 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr19: 26408746-26408831 [+]
sense
ENSECAT00000015392 ; LPP-201; intron 4
Database links

Mature sequence eca-miR-28-5p

Accession MIMAT0013092
Sequence

14 - 

aaggagcucacagucuauugag

 - 35

Get sequence
Deep sequencing22573 reads, 1 experiments
Evidence not experimental

Mature sequence eca-miR-28-3p

Accession MIMAT0013093
Sequence

54 - 

cacuagauugugagcuccugga

 - 75

Get sequence
Deep sequencing34573 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).