Stem-loop sequence eca-mir-1248

AccessionMI0012839 (change log)
DescriptionEquus caballus miR-1248 stem-loop
Gene family MIPF0000622; mir-1248
Literature search

2 open access papers mention eca-mir-1248
(2 sentences)

Stem-loop
   -uc        auaa c   g     ---aa                u 
5'    cuucuugu    g acu ugcua     auugcagaaacuagga c
      ||||||||    | ||| |||||     |||||||||||||||| a
3'    gaagaaca    c uga acgau     uaauguuuuugguucu c
   aaa        --ca a   g     cguaa                u 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr19: 24793833-24793925 [+]
sense
ENSECAT00000029273 ; SNORA81-201; exon 1
ENSECAT00000023158 ; EIF4A2-201; intron 7
Database links

Mature sequence eca-miR-1248

Accession MIMAT0013091
Sequence

1 - 

uccuucuuguauaagcacugugcuaaa

 - 27

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).