Stem-loop sequence eca-mir-20a

AccessionMI0012835 (change log)
DescriptionEquus caballus miR-20a stem-loop
Gene family MIPF0000001; mir-17
Literature search

2 open access papers mention eca-mir-20a
(4 sentences)

Stem-loop
       c   -a                 g   -  uu 
5' guag acu  aagugcuuauagugcag uag ug  u
   |||| |||  ||||||||||||||||| ||| ||   
3' cguc uga  uucacgaguauuacguc auc au  a
       a   aa                 -   u  ug 
Get sequence
Deep sequencing
638 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr17: 61792863-61792933 [+]
intergenic
Clustered miRNAs
< 10kb from eca-mir-20a
eca-mir-17chr17: 61792416-61792474 [+]
eca-mir-18achr17: 61792556-61792616 [+]
eca-mir-19achr17: 61792692-61792773 [+]
eca-mir-20achr17: 61792863-61792933 [+]
eca-mir-19bchr17: 61793002-61793065 [+]
eca-mir-92achr17: 61793120-61793180 [+]
Database links

Mature sequence eca-miR-20a

Accession MIMAT0013088
Sequence

8 - 

uaaagugcuuauagugcagguag

 - 30

Get sequence
Deep sequencing630 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).