Stem-loop sequence eca-mir-19b

AccessionMI0012834 (change log)
DescriptionEquus caballus miR-19b stem-loop
Gene family MIPF0000011; mir-19
Literature search

3 open access papers mention eca-mir-19b
(4 sentences)

Stem-loop
   g           -  -      uc    ugugu 
5'  uuaguuuugca gg uuugca  cagc     g
    ||||||||||| || ||||||  ||||     a
3'  agucaaaacgu cc aaacgu  gucg     u
   -           a  u      --    ucuug 
Get sequence
Deep sequencing
1942 reads, 100 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr17: 61793002-61793065 [+]
intergenic
Clustered miRNAs
< 10kb from eca-mir-19b
eca-mir-17chr17: 61792416-61792474 [+]
eca-mir-18achr17: 61792556-61792616 [+]
eca-mir-19achr17: 61792692-61792773 [+]
eca-mir-20achr17: 61792863-61792933 [+]
eca-mir-19bchr17: 61793002-61793065 [+]
eca-mir-92achr17: 61793120-61793180 [+]
Database links

Mature sequence eca-miR-19b

Accession MIMAT0013087
Sequence

42 - 

ugugcaaauccaugcaaaacuga

 - 64

Get sequence
Deep sequencing3930 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).