Stem-loop sequence eca-mir-19a

AccessionMI0012833 (change log)
DescriptionEquus caballus miR-19a stem-loop
Gene family MIPF0000011; mir-19
Literature search

2 open access papers mention eca-mir-19a
(3 sentences)

Stem-loop
       u  u                 --      ---    ag 
5' gcag cu cuguuaguuuugcauag  uugcac   uaca  a
   |||| || |||||||||||||||||  ||||||   ||||  a
3' cguc gg gguagucaaaacguauc  aacgug   augu  g
       c  u                 ua      uug    aa 
Get sequence
Deep sequencing
1907 reads, 100 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr17: 61792692-61792773 [+]
intergenic
Clustered miRNAs
< 10kb from eca-mir-19a
eca-mir-17chr17: 61792416-61792474 [+]
eca-mir-18achr17: 61792556-61792616 [+]
eca-mir-19achr17: 61792692-61792773 [+]
eca-mir-20achr17: 61792863-61792933 [+]
eca-mir-19bchr17: 61793002-61793065 [+]
eca-mir-92achr17: 61793120-61793180 [+]
Database links

Mature sequence eca-miR-19a

Accession MIMAT0013086
Sequence

49 - 

ugugcaaaucuaugcaaaacuga

 - 71

Get sequence
Deep sequencing1907 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).