Stem-loop sequence eca-mir-18a

AccessionMI0012832 (change log)
DescriptionEquus caballus miR-18a stem-loop
Gene family MIPF0000001; mir-17
Literature search

4 open access papers mention eca-mir-18a
(5 sentences)

Stem-loop
   u    u   uc   u    a   -  aa u 
5'  aagg gca  uag gcag uag ug  g a
    |||| |||  ||| |||| ||| ||  | g
3'  uucc cgu  auc cguc auc ac  u a
   c    u   ga   c    -   u  ga u 
Get sequence
Deep sequencing
103 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr17: 61792556-61792616 [+]
sense
ENSECAT00000027725 ; eca-mir-18a-201; exon 1
Clustered miRNAs
< 10kb from eca-mir-18a
eca-mir-17chr17: 61792416-61792474 [+]
eca-mir-18achr17: 61792556-61792616 [+]
eca-mir-19achr17: 61792692-61792773 [+]
eca-mir-20achr17: 61792863-61792933 [+]
eca-mir-19bchr17: 61793002-61793065 [+]
eca-mir-92achr17: 61793120-61793180 [+]
Database links

Mature sequence eca-miR-18a

Accession MIMAT0013085
Sequence

1 - 

uaaggugcaucuagugcagauag

 - 23

Get sequence
Deep sequencing103 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).