Stem-loop sequence eca-mir-17

AccessionMI0012831 (change log)
DescriptionEquus caballus miR-17 stem-loop
Gene family MIPF0000001; mir-17
Literature search

6 open access papers mention eca-mir-17
(8 sentences)

Stem-loop
   ca        a  g     g   -  aua 
5'   aagugcuu ca ugcag uag ug   u
     |||||||| || ||||| ||| ||   a
3'   uucacgga gu acguc auc ac   u
   ug        a  g     -   u  gug 
Get sequence
Deep sequencing
1424 reads, 100 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr17: 61792416-61792474 [+]
intergenic
Clustered miRNAs
< 10kb from eca-mir-17
eca-mir-17chr17: 61792416-61792474 [+]
eca-mir-18achr17: 61792556-61792616 [+]
eca-mir-19achr17: 61792692-61792773 [+]
eca-mir-20achr17: 61792863-61792933 [+]
eca-mir-19bchr17: 61793002-61793065 [+]
eca-mir-92achr17: 61793120-61793180 [+]
Database links

Mature sequence eca-miR-17

Accession MIMAT0013084
Sequence

1 - 

caaagugcuuacagugcagguag

 - 23

Get sequence
Deep sequencing1409 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).