Stem-loop sequence eca-mir-16-2

AccessionMI0012830 (change log)
DescriptionEquus caballus miR-16-2 stem-loop
Gene family MIPF0000006; mir-15
Literature search

2 open access papers mention eca-mir-16-2
(3 sentences)

Stem-loop
            -  a        c u   gauu 
5' uagcagcac gu aauauugg g uaa    c
   ||||||||| || |||||||| | |||     
3' gucgucgug ca uuaugacc c auu    u
            u  a        u u   aaaa 
Get sequence
Deep sequencing
25133 reads, 1.75e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr17: 21138923-21138985 [+]
sense
ENSECAT00000027373 ; eca-mir-16-2-201; exon 1
antisense
ENSECAT00000008358 ; KCNRG-201; intron 2
Clustered miRNAs
< 10kb from eca-mir-16-2
eca-mir-15achr17: 21138783-21138839 [+]
eca-mir-16-2chr17: 21138923-21138985 [+]
Database links

Mature sequence eca-miR-16

Accession MIMAT0012955
Sequence

1 - 

uagcagcacguaaauauuggcg

 - 22

Get sequence
Deep sequencing50285 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).