Stem-loop sequence eca-mir-16-2

Accession MI0012830
Description Equus caballus miR-16-2 stem-loop
Gene family MIPF0000006; mir-15
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-16_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-16 microRNA precursor family is a group of related small non-coding RNA genes that regulates gene expression. miR-16, miR-15, mir-195 and miR-457 are related microRNA precursor sequences from the mir-15 gene family. This microRNA family appears to be vertebrate specific and its members have been predicted or experimentally validated in a wide range of vertebrate species (MIPF0000006).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
         -  a        c u   gauu 
uagcagcac gu aauauugg g uaa    c
||||||||| || |||||||| | |||     
gucgucgug ca uuaugacc c auu    u
         u  a        u u   aaaa 
Get sequence
Genome context
Coordinates (EquCab2) Overlapping transcripts
17: 21138923-21138985 [+]
sense
antisense
ENSECAT00000008358 ; LOC100050085; intron 2
Clustered miRNAs
< 10kb from eca-mir-16-2
eca-mir-15a 17: 21138783-21138839 [+]
eca-mir-16-2 17: 21138923-21138985 [+]
Database links

Mature sequence eca-miR-16

Accession MIMAT0012955
Sequence

1 - 

uagcagcacguaaauauuggcg

 - 22

Get sequence
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).