Stem-loop sequence eca-mir-15a

AccessionMI0012829 (change log)
DescriptionEquus caballus miR-15a stem-loop
Gene family MIPF0000006; mir-15
Literature search

2 open access papers mention eca-mir-15a
(12 sentences)

Stem-loop
   ua        ua          ga  u 
5'   gcagcaca  augguuugug  uu u
     ||||||||  ||||||||||  || g
3'   cgucgugu  uaccggacgu  aa a
   uc        ua          gg  a 
Get sequence
Deep sequencing
1161 reads, 50 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr17: 21138783-21138839 [+]
sense
ENSECAT00000027533 ; eca-mir-15a-201; exon 1
antisense
ENSECAT00000008358 ; KCNRG-201; intron 2
Clustered miRNAs
< 10kb from eca-mir-15a
eca-mir-15achr17: 21138783-21138839 [+]
eca-mir-16-2chr17: 21138923-21138985 [+]
Database links

Mature sequence eca-miR-15a

Accession MIMAT0013083
Sequence

1 - 

uagcagcacauaaugguuugug

 - 22

Get sequence
Deep sequencing1161 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).