Stem-loop sequence eca-mir-711

AccessionMI0012827 (change log)
DescriptionEquus caballus miR-711 stem-loop
Gene family MIPF0000748; mir-711
Stem-loop
       uaa         ca    g  a   gc 
5' acuu   gucucuuuu  gggu cc cag  a
   ||||   |||||||||  |||| || |||   
3' ugaa   cagagaggg  ccca gg guc  a
       -ug         -a    g  -   ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr16: 38391299-38391359 [+]
sense
ENSECAT00000012935 ; COL7A1-201; intron 61
ENSECAT00000013001 ; COL7A1-202; intron 61
Database links

Mature sequence eca-miR-711

Accession MIMAT0013080
Sequence

39 - 

gggacccagggagagacguaag

 - 60

Get sequence
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).