Stem-loop sequence eca-mir-26a-2

AccessionMI0012826 (change log)
DescriptionEquus caballus miR-26a-2 stem-loop
Gene family MIPF0000043; mir-26
Literature search

3 open access papers mention eca-mir-26a-2
(6 sentences)

Stem-loop
      g  u   u         c          --g  ca 
5' gug cc cgu caaguaauc aggauaggcu   ug  g
   ||| || ||| ||||||||| ||||||||||   ||  g
3' cgc gg gca guucauugg ucuuauccgg   ac  u
      a  c   c         u          gua  cc 
Get sequence
Deep sequencing
181098 reads, 1.31e+04 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr16: 47241013-47241089 [-]
sense
ENSECAT00000025607 ; CTDSPL-201; intron 4
Database links

Mature sequence eca-miR-26a

Accession MIMAT0012975
Sequence

10 - 

uucaaguaauccaggauaggcu

 - 31

Get sequence
Deep sequencing362274 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).