Stem-loop sequence eca-mir-191a

AccessionMI0012825 (change log)
Previous IDseca-mir-191
DescriptionEquus caballus miR-191 stem-loop
Gene family MIPF0000194; mir-191
Literature search

5 open access papers mention eca-mir-191a
(8 sentences)

Stem-loop
         c          c  aa       uu  -  c 
5' agcggg aacggaaucc aa  gcagcug  gu cu c
   |||||| |||||||||| ||  |||||||  || ||  
3' ucgucc uugcuuuagg uu  cgucgac  ua ga a
         c          -  cg       cu  c  g 
Get sequence
Deep sequencing
107418 reads, 7.7e+03 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr16: 38001159-38001232 [+]
intergenic
Clustered miRNAs
< 10kb from eca-mir-191a
eca-mir-191bchr16: 38001138-38001256 [-]
eca-mir-191achr16: 38001159-38001232 [+]
eca-mir-425chr16: 38001590-38001732 [+]
Database links

Mature sequence eca-miR-191a

Accession MIMAT0013079
Previous IDseca-miR-191
Sequence

7 - 

caacggaaucccaaaagcagcug

 - 29

Get sequence
Deep sequencing107310 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).