Stem-loop sequence eca-mir-135a

AccessionMI0012823 (change log)
DescriptionEquus caballus miR-135a stem-loop
Gene family MIPF0000028; mir-135
Literature search

3 open access papers mention eca-mir-135a
(14 sentences)

Stem-loop
             uu            uucua 
5' cuauggcuuu  auuccuauguga     c
   ||||||||||  ||||||||||||     u
3' ggugccgagg  uagggauauacu     g
             -u            cacuc 
Get sequence
Deep sequencing
262 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr16: 35417146-35417205 [+]
intergenic
Database links

Mature sequence eca-miR-135a

Accession MIMAT0013078
Sequence

2 - 

uauggcuuuuuauuccuauguga

 - 24

Get sequence
Deep sequencing525 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).