Stem-loop sequence eca-mir-128-1

AccessionMI0012821 (change log)
Previous IDseca-mir-128
DescriptionEquus caballus miR-128 stem-loop
Gene family MIPF0000048; mir-128
Literature search

2 open access papers mention eca-mir-128-1
(21 sentences)

Stem-loop
   u ug       a          aug      ac    g gag 
5'  g  caguggg aggggggccg   cacugu  gaga u   u
    |  ||||||| ||||||||||   ||||||  |||| |    
3'  u  gucaucc uuucucuggc   gugaca  cucu g   a
   c gu       c          caa      --    g acg 
Get sequence
Deep sequencing
1815 reads, 50 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr16: 49087163-49087246 [-]
sense
ENSECAT00000024789 ; ARPP21-202; intron 16
ENSECAT00000024792 ; ARPP21-203; intron 16
ENSECAT00000024679 ; ARPP21-201; intron 18
Database links

Mature sequence eca-miR-128

Accession MIMAT0013076
Sequence

52 - 

ucacagugaaccggucucuuu

 - 72

Get sequence
Deep sequencing3715 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).