Stem-loop sequence eca-let-7g

Accession MI0012820
Description Equus caballus let-7g stem-loop
Gene family MIPF0000002; let-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled let-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The Let-7 microRNA precursor was identified from a study of developmental timing in C. elegans, and was later shown to be part of a much larger class of non-coding RNAs termed microRNAs. miR-98 microRNA precursor from human is a let-7 family member. Let-7 miRNAs have now been predicted or experimentally confirmed in a wide range of species (MIPF000002). miRNAs are initially transcribed in long transcripts (up to several hundred nucleotides) called primary miRNAs (pri-miRNAs), which are processed in the nucleus by Drosha and Pasha to hairpin structures of about ~70 nucleotide. These precursors (pre-miRNAs) are exported to the cytoplasm by exportin5, where they are subsequently processed by the enzyme Dicer to a ~22 nucleotide mature miRNA. The involvement of Dicer in miRNA processing demonstrates a relationship with the phenomenon of RNA interference.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
  a   u        a            ugagg    -a  a    a 
cc ggc gagguagu guuuguacaguu     gucu  ug uacc c
|| ||| |||||||| ||||||||||||     ||||  || ||||  
gg ccg uuccguca cggacaugucaa     uaga  ac augg c
  a   -        c            -----    gg  -    c 
Get sequence
Genome context
Coordinates (EquCab2) Overlapping transcripts
16: 35442180-35442267 [+]
sense
ENSECAT00000015138 ; LOC100060351; intron 1
Database links

Mature sequence eca-let-7g

Accession MIMAT0013075
Sequence

7 - 

ugagguaguaguuuguacaguu

 - 28

Get sequence
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).