Stem-loop sequence eca-let-7g

AccessionMI0012820 (change log)
DescriptionEquus caballus let-7g stem-loop
Gene family MIPF0000002; let-7
Literature search

6 open access papers mention eca-let-7g
(13 sentences)

Stem-loop
     a   u        a            ugagg    -a  a    a 
5' cc ggc gagguagu guuuguacaguu     gucu  ug uacc c
   || ||| |||||||| ||||||||||||     ||||  || ||||  
3' gg ccg uuccguca cggacaugucaa     uaga  ac augg c
     a   -        c            -----    gg  -    c 
Get sequence
Deep sequencing
175929 reads, 1.3e+04 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr16: 35442180-35442267 [+]
sense
ENSECAT00000015138 ; TWF2-201; intron 1
Database links

Mature sequence eca-let-7g

Accession MIMAT0013075
Sequence

7 - 

ugagguaguaguuuguacaguu

 - 28

Get sequence
Deep sequencing175914 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).