Stem-loop sequence eca-mir-9a-2

AccessionMI0012814 (change log)
DescriptionEquus caballus miR-9a-2 stem-loop
Gene family MIPF0000014; mir-9
Literature search

2 open access papers mention eca-mir-9a-2
(4 sentences)

Stem-loop
   --     g   uc               g      ug a 
5'   gaguu uua  uuugguuaucuagcu uaugag  u u
     ||||| |||  ||||||||||||||| ||||||  |  
3'   cucaa aau  aagccaauagaucga auacuu  g u
   uc     a   ga               a      cu g 
Get sequence
Deep sequencing
164 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr14: 78843147-78843224 [+]
sense
ENSECAT00000028020 ; eca-mir-9a-2-201; exon 1
Database links

Mature sequence eca-miR-9a

Accession MIMAT0012967
Sequence

10 - 

ucuuugguuaucuagcuguauga

 - 32

Get sequence
Deep sequencing322 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).