Stem-loop sequence eca-mir-146a

AccessionMI0012809 (change log)
DescriptionEquus caballus miR-146a stem-loop
Gene family MIPF0000103; mir-146
Literature search

4 open access papers mention eca-mir-146a
(38 sentences)

Stem-loop
       uu            c        --g  u 
5' agcu  gagaacugaauu cauggguu   ug c
   ||||  |||||||||||| ||||||||   ||  
3' ucga  uucuugacuuga guguccag   gc a
       -c            a        acu  g 
Get sequence
Deep sequencing
38184 reads, 2.7e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr14: 19243271-19243335 [-]
intergenic
Database links

Mature sequence eca-miR-146a

Accession MIMAT0013065
Sequence

6 - 

ugagaacugaauuccauggguu

 - 27

Get sequence
Deep sequencing38182 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).