Stem-loop sequence eca-mir-145

AccessionMI0012808 (change log)
DescriptionEquus caballus miR-145 stem-loop
Gene family MIPF0000079; mir-145
Literature search

4 open access papers mention eca-mir-145
(5 sentences)

Stem-loop
       c  uc    u  c            uagau 
5' cuca gg  cagu uu ccaggaaucccu     g
   |||| ||  |||| || ||||||||||||     c
3' gagu uc  guca aa gguccuuagggg     u
       -  uu    u  a            uagaa 
Get sequence
Deep sequencing
8233 reads, 500 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr14: 28433270-28433339 [-]
sense
ENSECAT00000028215 ; eca-mir-145-201; exon 1
Clustered miRNAs
< 10kb from eca-mir-145
eca-mir-143chr14: 28434698-28434761 [-]
eca-mir-145chr14: 28433270-28433339 [-]
Database links

Mature sequence eca-miR-145

Accession MIMAT0013064
Sequence

7 - 

guccaguuuucccaggaaucccu

 - 29

Get sequence
Deep sequencing5823 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).