Stem-loop sequence eca-mir-1271a

AccessionMI0012806 (change log)
Previous IDseca-mir-1271
DescriptionEquus caballus miR-1271 stem-loop
Gene family MIPF0000483; mir-1271
Stem-loop
   -        cuc   a           a 
5'  cuuggcac   gua gcacucaguaa u
    ||||||||   ||| |||||||||||  
3'  ggaccgug   cgu cgugaguuguu a
   c        ugu   c           c 
Get sequence
Deep sequencing
1515 reads, 50 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr14: 5745062-5745118 [-]
sense
ENSECAT00000000412 ; ARL10-201; intron 1
Database links

Mature sequence eca-miR-1271a

Accession MIMAT0013062
Previous IDseca-miR-1271
Sequence

1 - 

cuuggcaccucguaagcacuca

 - 22

Get sequence
Deep sequencing1514 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).