Stem-loop sequence eca-mir-107a

AccessionMI0012805 (change log)
DescriptionEquus caballus miR-107a stem-loop
Gene family MIPF0000024; mir-103
Literature search

2 open access papers mention eca-mir-107a
(6 sentences)

Stem-loop
   c   cu     c gcuucuu           c   u g g 
5'  uca  gcccu g       uacagugcugc uug u c g
    |||  ||||| |       ||||||||||| ||| | |  
3'  agu  cggga c       auguuacgacg aac a g a
   -   au     - -------           -   u g u 
Get sequence
Deep sequencing
6894 reads, 350 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr14: 12370468-12370539 [+]
sense
ENSECAT00000022424 ; PANK3-201; intron 5
Database links

Mature sequence eca-miR-107a

Accession MIMAT0013061
Sequence

50 - 

agcagcauuguacagggcuauga

 - 72

Get sequence
Deep sequencing6886 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).