Stem-loop sequence eca-mir-365-2

AccessionMI0012802 (change log)
DescriptionEquus caballus miR-365-2 stem-loop
Gene family MIPF0000061; mir-365
Stem-loop
   acc      aa        ac           ----   -   uuu 
5'    gcaggg  aaugaggg  uuuugggggca    gau gug   c
      ||||||  ||||||||  |||||||||||    ||| |||   c
3'    cguucu  uuauuccu  aaaauccccgu    cua cac   a
   --a      cg        -a           aaua   u   cuu 
Get sequence
Deep sequencing
90 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr13: 30682630-30682716 [-]
intergenic
Clustered miRNAs
< 10kb from eca-mir-365-2
eca-mir-193bchr13: 30687480-30687548 [-]
eca-mir-365-2chr13: 30682630-30682716 [-]
Database links

Mature sequence eca-miR-365

Accession MIMAT0013038
Sequence

56 - 

uaaugccccuaaaaauccuuau

 - 77

Get sequence
Deep sequencing176 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).