Stem-loop sequence eca-mir-106b

AccessionMI0012797 (change log)
DescriptionEquus caballus miR-106b stem-loop
Gene family MIPF0000001; mir-17
Literature search

1 open access papers mention eca-mir-106b
(1 sentences)

Stem-loop
   ua       g       a -aua    uc 
5'   aagugcu acagugc g    gugg  c
     ||||||| ||||||| |    ||||   
3'   uucaugg ugucacg c    uacc  u
   cg       g       c aucg    uc 
Get sequence
Deep sequencing
308 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr13: 8034691-8034749 [-]
sense
ENSECAT00000015853 ; MCM7-201; intron 13
Clustered miRNAs
< 10kb from eca-mir-106b
eca-mir-106bchr13: 8034691-8034749 [-]
eca-mir-93chr13: 8034465-8034523 [-]
eca-mir-25chr13: 8034246-8034329 [-]
Database links

Mature sequence eca-miR-106b

Accession MIMAT0013054
Sequence

1 - 

uaaagugcugacagugcagau

 - 21

Get sequence
Deep sequencing289 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).