Stem-loop sequence eca-mir-675

AccessionMI0012796 (change log)
DescriptionEquus caballus miR-675 stem-loop
Gene family MIPF0000365; mir-675
Literature search

2 open access papers mention eca-mir-675
(9 sentences)

Stem-loop
               c    a      cc      -     
5' cccaggggcugg gcgg gagggc  acagug cacu 
   |||||||||||| |||| ||||||  |||||| ||| c
3' ggguccccgacu cgcc cuuccg  ugucac guga 
               -    a      ua      a     
Get sequence
Deep sequencing
23 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr12: 30529069-30529141 [-]
sense
ENSECAT00000026377 ; eca-mir-675-201; exon 4
antisense
ENSECAT00000026368 ; MRPL23-201; intron 4
Database links

Mature sequence eca-miR-675

Accession MIMAT0013053
Sequence

10 - 

uggcgcggagagggcccacagug

 - 32

Get sequence
Deep sequencing14 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).