Stem-loop sequence eca-mir-493a

AccessionMI0012794 (change log)
DescriptionEquus caballus miR-493a stem-loop
Literature search

1 open access papers mention eca-mir-493a
(2 sentences)

Stem-loop
        g      gc  g     a   -----   uaa 
5' ccugg augcag  ga uuagg gaa     auc   c
   ||||| ||||||  || ||||| |||     |||    
3' ggacc uguguc  cu gguuc cuu     uag   a
        g      au  g     -   auaaa   cua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr12: 10298217-10298286 [-]
intergenic
Database links

Mature sequence eca-miR-493a

Accession MIMAT0013051
Sequence

49 - 

cuugggucuacugugugccagg

 - 70

Get sequence
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).