Stem-loop sequence eca-mir-194-1

AccessionMI0012793 (change log)
Previous IDseca-mir-194
DescriptionEquus caballus miR-194 stem-loop
Gene family MIPF0000055; mir-194
Literature search

1 open access papers mention eca-mir-194-1
(1 sentences)

Stem-loop
   -g       a    cu         acuccauguggaagugc 
5'   ggcuccc cccc  guaacagca                 c
     ||||||| ||||  |||||||||                  
3'   ccggggg gggg  uauugucgu                 c
   ga       c    uc         cggggugaccuugguca 
Get sequence
Deep sequencing
25 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr12: 25044429-25044513 [-]
intergenic
Clustered miRNAs
< 10kb from eca-mir-194-1
eca-mir-194-1chr12: 25044429-25044513 [-]
eca-mir-192chr12: 25044238-25044298 [-]
eca-mir-9119chr12: 25043170-25043302 [+]
Database links

Mature sequence eca-miR-194

Accession MIMAT0013050
Sequence

15 - 

uguaacagcaacuccaugugga

 - 36

Get sequence
Deep sequencing50 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).