Stem-loop sequence eca-mir-129b

AccessionMI0012789 (change log)
DescriptionEquus caballus miR-129b stem-loop
Gene family MIPF0000073; mir-129
Stem-loop
         -       c   cu      ---     acau 
5' gcgaau cuuuuug ggu  gggcuu   gcugu    a
   |||||| ||||||| |||  ||||||   |||||     
3' cgcuua gaaaaac cca  cccgaa   cgaua    a
         c       c   uu      ggc     acuc 
Get sequence
Deep sequencing
128 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr12: 8530962-8531035 [+]
intergenic
Database links

Mature sequence eca-miR-129b-5p

Accession MIMAT0013045
Sequence

7 - 

cuuuuugcggucugggcuugc

 - 27

Get sequence
Deep sequencing80 reads, 1 experiments
Evidence not experimental

Mature sequence eca-miR-129b-3p

Accession MIMAT0013046
Sequence

49 - 

aagcccuuaccccaaaaagcau

 - 70

Get sequence
Deep sequencing48 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).