Stem-loop sequence eca-mir-497

AccessionMI0012787 (change log)
DescriptionEquus caballus miR-497 stem-loop
Gene family MIPF0000231; mir-497
Stem-loop
   c    g    c         u  --   ac 
5'  agca caca ugugguuug ac  ggc  u
    |||| |||| ||||||||| ||  |||   
3'  uugu gugu acaccaaac ug  ccg  g
   -    g    c         c  ca   gu 
Get sequence
Deep sequencing
1927 reads, 100 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr11: 50049193-50049251 [-]
sense
ENSECAT00000027371 ; eca-mir-497-201; exon 1
Clustered miRNAs
< 10kb from eca-mir-497
eca-mir-497chr11: 50049193-50049251 [-]
eca-mir-195chr11: 50048869-50048962 [-]
Database links

Mature sequence eca-miR-497

Accession MIMAT0013043
Sequence

1 - 

cagcagcacacugugguuugu

 - 21

Get sequence
Deep sequencing1925 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).